RESISTANCE OF SERRATIA MARCESCENS (SPKD15) TO VARIOUS ENVIRONMENTAL STRESS CONDITIONS: EFFECT ON CELL VIABILITY AND PRODIOGISIN PRODUCTION

{ DOWNLOAD AS PDF }

ABOUT AUTHORS
1PRATYUSH KUMAR DAS*, 2SMRUTIPRAGNYA SAMAL, 3RATIKANTA SAHOO, 4PRASANT KUMAR SABAT
1,2,3Centre for Biotechnology, Siksha ‘O’ Anusandhan (Deemed to be University), Bhubaneswar, Odisha, India – 751003
4School of Pharmaceutical Sciences, Siksha ‘O’ Anusandhan (Deemed to be University), Bhubaneswar, Odisha, India – 751003
*pratyushdas@soa.ac.in

ABSTRACT
Serratia marcescens, a gram negative bacillus is generally related to hospital acquired infections. Production of red pigment (Prodiogisin) by the bacterium is an important characteristic feature and has been reported to exhibit certain antimicrobial property. The resistance of the bacteria towards several classes of antibiotics makes it one of the most notorious pathogen. The work aimed to evaluate the resistance of Serratia marcescens (SPKD15) under various environmental stress conditions (temperature, pH, Salt concentration and UV). Effect of these stress conditions on the cell viability and production of prodiogisin was analysed. The strain was able to sustain up to temperature of 40°C, Salt (NaCl) concentration of 7%, pH up to 10 and could withstand UV radiations up to 2 minutes. However, the prodiogisin production was negatively affected and finally inhibited at all the conditions of environmental stress(Temperature = 35°C, pH = 4 and 9, Nacl concentration = 4% and UV exposure of 15 seconds). This indicates that prodiogisin may act as a protective mechanism for the bacterium under stress. Further, intracellular antimicrobial was obtained from the UV exposed culture and compared with the antimicrobial obtained from the normal culture. The antimicrobial obtained from UV exposed culture showed decreased antimicrobial effect with inhibition diameter ranging between 2 mm to 13 mm (± S.D) as compared to the antimicrobial obtained from the normal culture. An inhibition diameter ranging between 4 mm to 22 mm (± S.D) was obtained in case of the normal culture which may be attributed to the loss of pigmentation. The study highlights the resistance of the bacterium to various environmental stresses. Keeping the degree of pathogenicity of the bacterium in mind, eradication of the same is quite difficult and must be looked upon seriously.

Reference Id: PHARMATUTOR-ART-2579

PharmaTutor (Print-ISSN: 2394 - 6679; e-ISSN: 2347 - 7881)

Volume 6, Issue 4

Received On: 22/02/2018; Accepted On: 07/03/2018; Published On: 01/04/2018

How to cite this article: Das PK, Samal S, Sahoo R, Sabat PK; Resistance of Serratia marcescens (SPKD15) to various environmental stress conditions: Effect on cell viability and prodiogisin production; PharmaTutor; 2018; 6(4); 18-26;  http://dx.doi.org/10.29161/PT.v6.i4.2018.18

INTRODUCTION:
Serratia marcescens is a gram negative bacillus mostly responsible for hospital – acquired infection. Previously also known as Chromobacterium prodigiosum, the name Serratia marcescens was assigned in 1823 by Bizio (Hejazi and Falkiner, 1997). The most important characteristic feature of Serratia is production of red color pigment associated with the cell, called Prodigiosin. This pigment is generally not synthesized in strains isolated from infected adults (Singlton and Sainsbury, 2001; Ding and Williams, 1983). The pigment color varies from pink to dark or blood red depending on the age of colonies (Bunting, 1942). S.marcescens is mainly related to nosocomical infections, infections of urinary tract and was previously considered to be a non-pathogenic and saprophytic water organism. It was generally used as a biological marker because of its red colonies. Professor Scheurlen of the University of Strasbourg in 1896 concluded that the organism lead to more number of deaths as compared to many other pathogenic bacteria (Wheat et al., 1951). S.marcescens has been also reported to cause respiratory tract infection, meningitis, septicaemia and wound infections (Gouin et al., 1993) along with infective endocarditis (Mills and Drew, 1976). Yang et al., (2012) reported that S.marcescens also shows resistance towards a number of antimicrobial agents including β-lactams, Fluoroquinolones and Aminoglycosides.

The objective of the study was to analyze the resistance of Serratia marcescens (SPKD15), to various environmental stress conditions (Temperature, Salt concentration, pH and UV) with respect to cell viability and prodiogisin production. Further, the effect of UV on the production of intracellular antimicrobial by the strain was analyzed to establish a probable conclusion.

METHODS:

Isolation of Bacteria:
The desired bacterium was isolated from garden soil obtained from the premises of Srirama Chandra Bhanja Medical College and Hospital, Cuttack, Odisha by serial dilution technique, followed by the spread plate method. Further the colony morphology was studied and the desired colony (red colored, Smooth and glistening surface) was sub-cultured by streak plate method. The bacterial culture was then subjected to gram staining using HIMEDIA staining kit. The prepared slides were observed under 100X oil immersion objective to confirm the structure of the cell wall and the presence or absence of spores respectively.

Biochemical Identification:
Biochemical identification was carried out by API 20E test – a strip containing 20 different ready to use media for the purpose of biochemical identification of enterobacteriaceae species (Ingledew et al., 1980).

16S r RNA Sequencing:
In the process, first the bacterial chromosomal DNA was isolated by ROSE (Rapid One Step Extraction) method (Steiner et al., 1995) and quantified. Amplification of 16S rRNA gene was carried out using genomic DNA of Serratiamarcescens SPKD15 as the template along with universal primers – 8F (5'AGAGTTTGATCCTGGCTCAG3') and 1492R (5'GGTTACCTTGTTACGACTT3'). The PCR clone was sequenced by SCI Genom (P.) Ltd., India.

Comparison and Submission of Sequence:
The sequences received was subjected to Mega BLAST and compared with other available sequences in the National Centre for Biotechnology Information (NCBI)Genbank database. Before submission the sequences were checked and cleaned for “Chimeras” using online software – DECIPHER (Wright et al., 2012) and then submitted to NCBI.

Antimicrobial Susceptibility Test:
Antimicrobial susceptibility test on the isolated strain was carried out by using Kirby-Bauer’s disc diffusion method as per the guidelines of Clinical Laboratory Standard Institute (CLSI). The antibiotic discs taken for analysis are Imipenem (IC 10/10 µg), Piperacillin (PI 100µg), Amoxyclav (AMC 30µg) and Cefoxitin (CX 30µg) of HIMEDIA make. Based on the zone of inhibitions measured, the data was used to generate an antibiogram report by using ABIS online antibiogram analyser 1.0 software (ABIS ONLINE).

Effect of Stress conditions on growth of Serratia marcescens (SPKD15) and Prodigiosin production:
Effect of various stress conditions viz. temperature, salt concentration, pH and exposure to UV on the growth of Serratia marcescens SPKD15 and production of Prodigiosin(Red Pigment) was studied by performing colony count and calculating the percentage in relation to the control.

Effect of temperature:
The bacterial culture broth was spread on different petri plates containing nutrient agar medium and incubated under different temperature conditions (20⁰C - 45⁰C) for 24-48 hours. Results were noted thereafter (Noor et al., 2003).

Effect of salt concentration:
Similarly, bacterial culture spread on different nutrient agar plates containing NaCl concentration of 1%, 2%, 3%, 4%, 5%, 6% and 7% respectively were incubated for 24-48 hours, followed by observation (Aneja, 2003).

Effect of pH:
The bacterial culture was grown in various pH conditions ranging from pH 4 to pH 10 in nutrient hi-veg broth (HIMEDIA) for 24 hours at the optimum temperature of 25°C-27°C. The observation was noted after the incubation period (Aneja, 2003).

Effect of UV exposure:
100µl each of Serratia marcescens SPKD15 culture was spread on nutrient agar plates (in triplicates) and exposed to UV at 254 nm for a period of time ranging from 10 seconds to 3 minutes respectively and then incubated along with controls. Moreover, several streak plate (pure) culture of the strain was exposed to UV for a period of 5, 10, 20 and 30 minutes respectively. The UV exposed pure culture were again sub cultured on to freshly prepared nutrient agar plates (Aneja, 2003).

Effect of exposure to UV on production of intracellular antimicrobials by Serratia marcescens SPKD15:
The streak (pure culture) plate was exposed to UV by keeping the plate with its lid open at a distance of 15 cm away from the UV lamp inside a laminar airflow for duration of 30 minutes. After exposure to UV for the mentioned time, culture from the exposed plate was further sub-cultured in freshly prepared nutrient agar media. Microbial culture from the sub-cultured plate was taken by the help of an inoculation loop and was mixed with 50 ml of freshly prepared Luria Bertani (LB) broth and incubated for duration of 24 hours. After incubation, intracellular antimicrobial was extracted from the broth culture following the protocol established by Das et al. (Das et al., 2014). The same process was carried out to extract antimicrobial from the normal culture (control). The intracellular antimicrobial thus obtained from the bacteria after being exposed to UV, was used to study its inhibitory effect on various gram positive and gram negative microorganisms by agar well diffusion method. The antimicrobial obtained was tested against 4 bacterial cultures viz. Pseudomonas aeruginosa(ATCC 27853), Bacillus subtilis (MTCC121), Staphylococcou saureus (MTCC1144) andKlebssiella pnemoniae (MTCC432).The test was carried out in triplicates in order to avoid redundancy in results.The results obtained were compared with that exhibited by the controlto draw a meaningful conclusion.

NOW YOU CAN ALSO PUBLISH YOUR ARTICLE ONLINE.

SUBMIT YOUR ARTICLE/PROJECT AT editor-in-chief@pharmatutor.org

Subscribe to Pharmatutor Alerts by Email

FIND OUT MORE ARTICLES AT OUR DATABASE


Pages

FIND MORE ARTICLES